Sequence ID | >WENV170704343 |
Genome ID | LLEJ01004495 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 693 |
End posion on genome | 609 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tgagtaacat |
tRNA gene sequence |
GCGGACGTGGTGGAATTGGTAGACACACCAGATTTAGGTTCTGGCGCCGCGAGGTGTGAG |
Downstream region at tRNA end position |
tctaaaggtt |
Secondary structure (Cloverleaf model) | >WENV170704343 Leu TAG t ACCA tctaaaggtt G - C C - G G - C G - C A - T C - G G + T T G T C T C T C A T A A G | | | | | G T G G T G G A G A G C G | | | T T G A C A C T A G A CGCCGCGAGGTGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |