Sequence ID | >WENV170704351 |
Genome ID | LLEJ01004632 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 286 |
End posion on genome | 373 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ataaatgcgt |
tRNA gene sequence |
GGAGAGATGGCTGAGTGGTCGAAAGCAACGGTCTTGAAAACCGTCGTGTCGTAAGGCACC |
Downstream region at tRNA end position |
ttttttttta |
Secondary structure (Cloverleaf model) | >WENV170704351 Ser TGA t GCCA ttttttttta G - C G - C A - T G - C A - T G + T A - T T A T G T C C C A T G A G | | | | | G G G T C G C A G G G C G | | | T T T A A G C C G A A CGTGTCGTAAGGCACC A - T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |