Sequence ID | >WENV170704352 |
Genome ID | LLEJ01004632 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 406 |
End posion on genome | 495 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
aatatcattt |
tRNA gene sequence |
GGAAAGGTGGCAGAGCGGCTTATCGCGCACCCCTGCTAAGGGTGTGAACCTTCACAGGTT |
Downstream region at tRNA end position |
ttctagatat |
Secondary structure (Cloverleaf model) | >WENV170704352 Ser GCT t GCCA ttctagatat G - C G - C A - T A - T A - T G - C G + T T A T C T C C C A C G A G | | | | | A G G A C G G A G G G C G + | | T T C T C G C T T A G TGAACCTTCACAGGTTCC C - G A - T C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |