Sequence ID | >WENV170704370 |
Genome ID | LLEJ01004944 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 311 |
End posion on genome | 221 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cccgtgttac |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGCCGAAGGCGCTCCCCTGCTAAGGGAGTACACCTCAAAAGGGT |
Downstream region at tRNA end position |
tatttagtgt |
Secondary structure (Cloverleaf model) | >WENV170704370 Ser GCT c GCCA tatttagtgt G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T C A G G C C G A G TACACCTCAAAAGGGTGTC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |