Sequence ID | >WENV170704372 |
Genome ID | LLEJ01004946 |
Phylum/Class | [LLEJ] bioreactor metagenome; day101 10degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 83 |
End posion on genome | 169 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tatacatcat |
tRNA gene sequence |
GCCGAAGTGGTGAAACTGGCAGACGCGCTGGACTCAAAATCCAGTGGTAGTGATACCGTA |
Downstream region at tRNA end position |
aataaaaaca |
Secondary structure (Cloverleaf model) | >WENV170704372 Leu CAA t ACCA aataaaaaca G - C C - G C - G G - C A - T A - T G - C T G T T G C C C A C A A G | | | | | G T A G T G A C G G G C G | + | T T G A C G C C A G G TGGTAGTGATACCGT C - G T - A G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |