Sequence ID | >WENV170704394 |
Genome ID | LLEK01000014 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 45806 |
End posion on genome | 45881 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
taacaaatat |
tRNA gene sequence |
GACCTGTTAGCTCAGTCGGTAGAGCATCTCCCTTTTAAGGAGGTGGCCGTTGGTTCGAAT |
Downstream region at tRNA end position |
tgaatttgga |
Secondary structure (Cloverleaf model) | >WENV170704394 Lys TTT t ACCA tgaatttgga G - C A - T C - G C - G T + G G - C T - A T A T C A A C C A T G A A | | | | | G C C T C G G T T G G C G | | | | T T G G A G C T A A TGGCC T + G C - G T - A C - G C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |