Sequence ID | >WENV170704399 |
Genome ID | LLEK01000023 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 14705 |
End posion on genome | 14630 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gtttttaaat |
tRNA gene sequence |
GCTTCAGTAGCTCAGCTGGTAGAGCAGCTGATTTGTAATCAGCAGGTCGTAGGTTCAAGT |
Downstream region at tRNA end position |
ttttatcatt |
Secondary structure (Cloverleaf model) | >WENV170704399 Thr TGT t TCCA ttttatcatt G - C C - G T - A T - A C - G A - T G - C T G T T A T C C A C G A A + | | | | A T C T C G G T A G G C G | | | | T T G G A G C T A A AGGTC G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |