Sequence ID | >WENV170704402 |
Genome ID | LLEK01000023 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 14277 |
End posion on genome | 14203 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gtaaaatatc |
tRNA gene sequence |
GCCCACGTAGCTCAGGGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCGTAAGTTCAAGTC |
Downstream region at tRNA end position |
cttataaaat |
Secondary structure (Cloverleaf model) | >WENV170704402 Thr GGT c TCCA cttataaaat G - C C - G C - G C A A - T C - G G - C T G T T A T T C A G A A + | | | | A G C T C G G T A A G C G | | | | T T G G A G C T A A AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |