Sequence ID | >WENV170704403 |
Genome ID | LLEK01000023 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 12651 |
End posion on genome | 12576 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ctttgaaaaa |
tRNA gene sequence |
AGGCCAATAGCTCCAATGGTAGAGCACCGGATTCCAAATCCGGGTGTTGGGGGTTCGAGT |
Downstream region at tRNA end position |
ctaaactaaa |
Secondary structure (Cloverleaf model) | >WENV170704403 Trp CCA a GCCA ctaaactaaa A - T G - C G - C C - G C - G A - T A - T T G T C T C C C A A A C A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A A GTGTT C - G C - G G - C G - C A - T T A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |