Sequence ID | >WENV170704406 |
Genome ID | LLEK01000035 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 3376 |
End posion on genome | 3291 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gtttcattat |
tRNA gene sequence |
GCCCGTATGGTGAAATTGGTAAACACGCCGGATTCAAAATCCGGTGCTCTTAGAGCTTAA |
Downstream region at tRNA end position |
tcaatctaca |
Secondary structure (Cloverleaf model) | >WENV170704406 Leu CAA t ACCA tcaatctaca G + T C - G C - G C - G G - C T - A A - T T G T T T G C C A T A A G | | | | | A T A G T G A A C G G C G | | | T T G A C A C T A A G TGCTCTTAGAGCTT C - G C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |