Sequence ID | >WENV170704407 |
Genome ID | LLEK01000039 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 18689 |
End posion on genome | 18766 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
atgaaatttt |
tRNA gene sequence |
GACCTCGTAGCTCAACTGGATAGAGCACGGTACTTCTACCACCGGATGTTGAGGGTTCGA |
Downstream region at tRNA end position |
aaccttaccc |
Secondary structure (Cloverleaf model) | >WENV170704407 Arg TCT t ACCA aaccttaccc G - C A - T C - G C - G T - A C - G G - C T A T C T T C C A C A A A | | + | | G T C T C G G A G G G C G | | | | T T G G A G C A T A A GATGTT C - G G - C G - C T - A A C C C T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |