Sequence ID | >WENV170704408 |
Genome ID | LLEK01000044 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 7391 |
End posion on genome | 7465 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
aaagcaggtt |
tRNA gene sequence |
GCCGAAGTAGCTCAGGGGTAGAGCAACTGATTCGTAATCAGTAGGTCGGAGGTTCAAATC |
Downstream region at tRNA end position |
tgtttttcaa |
Secondary structure (Cloverleaf model) | >WENV170704408 Thr CGT t ACCA tgtttttcaa G - C C - G C - G G - C A - T A - T G - C T A T T C T C C A G A A + | | | | A G C T C G G G A G G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |