Sequence ID | >WENV170704410 |
Genome ID | LLEK01000058 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 19909 |
End posion on genome | 19819 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
caatccaaaa |
tRNA gene sequence |
GGACGAGTGGGTGAGTTGGCTGAAACCACATCCCTGCTAAGGATGCGTACTGGTAACGGT |
Downstream region at tRNA end position |
cttataaatc |
Secondary structure (Cloverleaf model) | >WENV170704410 Ser GCT a GCCA cttataaatc G - C G - C A - T C - G G - C A - T G - C T A T C T C T C A T T G A G | | | | | G G G T G G G A G A G C G | | | T T C A A C C T G A A CGTACTGGTAACGGTACC C - G A - T T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |