Sequence ID | >WENV170704411 |
Genome ID | LLEK01000086 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 10317 |
End posion on genome | 10227 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aagatattgc |
tRNA gene sequence |
GGACAGATGGCCGAGTGGCTGAAGGCGCTCGCCTGGAACGCGGGTATGGGTTAACAGCTC |
Downstream region at tRNA end position |
tctttttcta |
Secondary structure (Cloverleaf model) | >WENV170704411 Ser GGA c GCCA tctttttcta G - C G - C A - T C - G A - T G - C A - T T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T C A G G C T G A G TATGGGTTAACAGCTCATC C - G T + G C - G G - C C - G C C T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |