Sequence ID | >WENV170704414 |
Genome ID | LLEK01000118 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 4586 |
End posion on genome | 4678 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tttcacatat |
tRNA gene sequence |
GGACAGTTGGGTGAGTCGGCTGAAACCACCTCCCTGCTAAGGAGGCATACCCTTTATCGG |
Downstream region at tRNA end position |
caaaaacccg |
Secondary structure (Cloverleaf model) | >WENV170704414 Ser GCT t GCCA caaaaacccg G - C G - C A - T C - G A - T G - C T - A T A T C T C C C A C T G A G | | | | | G G G T G G G A G G G C G | | | T T C A A C C T G A A CATACCCTTTATCGGGTATC C - G C - G T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |