Sequence ID | >WENV170704419 |
Genome ID | LLEK01000125 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 13088 |
End posion on genome | 13164 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
aattacaaac |
tRNA gene sequence |
GCGTCTATGGCTTAACTGGATATAGCACTGGGTTTCGGCCCCGGCGGTTGTGGGTTCGAA |
Downstream region at tRNA end position |
tttaatgaag |
Secondary structure (Cloverleaf model) | >WENV170704419 Arg TCG c GCCA tttaatgaag G + T C - G G - C T + G C - G T - A A - T T A T C A T C C A C A A G | | + | | G T T T C G G T G G G C G | | | T T G T A G C A T A A CGGTT C - G T + G G - C G - C G - C T C T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |