Sequence ID | >WENV170704420 |
Genome ID | LLEK01000128 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 10831 |
End posion on genome | 10757 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
accacacaga |
tRNA gene sequence |
TGGGGCATCGCCAAGCGGTAAGGCAACGGTTTTTGGTATCGTCATCCCCAGGTTCGAATC |
Downstream region at tRNA end position |
aaagaaaccc |
Secondary structure (Cloverleaf model) | >WENV170704420 Gln TTG a GCCA aaagaaaccc T - A G - C G - C G - C G - C C - G A - T T A T G G T C C A G A C | | | | | G C A C C G C C A G G C G | | | T T G A G G C T A A CATCC A - T C - G G - C G + T T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |