Sequence ID | >WENV170704422 |
Genome ID | LLEK01000159 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 5683 |
End posion on genome | 5609 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
agcgtatatt |
tRNA gene sequence |
GCTGATGTAGCTCAGTGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCGGTAGTTCAATCC |
Downstream region at tRNA end position |
tgttaaaccc |
Secondary structure (Cloverleaf model) | >WENV170704422 Thr GGT t ACCA tgttaaaccc G - C C - G T - A G - C A - T T - A G - C C T T T C A T C A G A A + | | | | A T C T C G G G T A G C G | | | | T T G G A G C T A A AGGTC C - G T - A C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |