Sequence ID | >WENV170704424 |
Genome ID | LLEK01000172 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 6386 |
End posion on genome | 6472 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
atgcctttat |
tRNA gene sequence |
GGCGGCGTGATGGAATTGGTAGACGTGTTGGATTCAAAATCCAATGGTGGTGACACCGTG |
Downstream region at tRNA end position |
cattcgttct |
Secondary structure (Cloverleaf model) | >WENV170704424 Leu CAA t ACCA cattcgttct G + T G - C C - G G - C G - C C - G G - C T C T C G G C C A T A A G | | | | | G T G G T A G C C G G C G | + | T T G A C G T T A G G TGGTGGTGACACCGT T - A T - A G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |