Sequence ID | >WENV170704427 |
Genome ID | LLEK01000212 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 4919 |
End posion on genome | 4845 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
agaagattaa |
tRNA gene sequence |
GCGGGCGTAGCTCAGGGGTAGAGCGAAACCTTGCCAAGGTTTAGGTCGAGAGTTCGAATC |
Downstream region at tRNA end position |
tcttctaaaa |
Secondary structure (Cloverleaf model) | >WENV170704427 Gly GCC a TCCA tcttctaaaa G - C C - G G - C G - C G - C C - G G - C T A T T T C T C A G A A + | | | | G G C T C G G A G A G C G | | | | T T G G A G C T A G AGGTC A - T A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |