Sequence ID | >WENV170704430 |
Genome ID | LLEK01000244 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 7935 |
End posion on genome | 7849 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tttgaagaat |
tRNA gene sequence |
GCCCAGGTGGCGGAATTGGTAGACGCGCAGGTTTCAGGTACCTGTGGCCGCAAGGCCGTG |
Downstream region at tRNA end position |
ttcttctgta |
Secondary structure (Cloverleaf model) | >WENV170704430 Leu CAG t ACCA ttcttctgta G - C C - G C - G C - G A - T G + T G - C T C T T C T T C A T A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C T A G G TGGCCGCAAGGCCGT C - G A - T G - C G - C T - A T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |