Sequence ID | >WENV170704442 |
Genome ID | LLEK01000409 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 6020 |
End posion on genome | 6104 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ctcttcctat |
tRNA gene sequence |
GGAGGGATGCCTGAGCGGCTAAAAGGGGCGGACTGTAAATCCGCTGGCTACGCCTACGTT |
Downstream region at tRNA end position |
ccgctaaggg |
Secondary structure (Cloverleaf model) | >WENV170704442 Tyr GTA t ACCA ccgctaaggg G - C G - C A - T G - C G - C G - C A - T T A T C A A C C A C G A G | | | | | G G G T C C G T T G G C G | | | T T C A A G G T A A G TGGCTACGCCTAC G - C C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |