Sequence ID | >WENV170704449 |
Genome ID | LLEK01000477 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 2139 |
End posion on genome | 2214 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
accatctata |
tRNA gene sequence |
GGGGGTGTAGCTCAGTTGGGAGAGCATCTGATTTGCATTCAGAAGGTCATCGGTTCGATC |
Downstream region at tRNA end position |
gcttttgctt |
Secondary structure (Cloverleaf model) | >WENV170704449 Ala TGC a ACCA gcttttgctt G - C G - C G + T G - C G - C T - A G - C C T T T T G C C A T G A A | | | | G T C T C G A T C G G C G | | | | T T G G A G C G A A AGGTC T - A C - G T - A G - C A - T T T T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |