Sequence ID | >WENV170704473 |
Genome ID | LLEK01000910 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1089 |
End posion on genome | 1173 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tttggacaat |
tRNA gene sequence |
GCGGGTGTGGTGAAATTGGTAGACACGCCAGATTTAGGTTCTGGTGGCGCAAGCCGTGGG |
Downstream region at tRNA end position |
aaggtatcaa |
Secondary structure (Cloverleaf model) | >WENV170704473 Leu TAG t ACCA aaggtatcaa G - C C - G G - C G - C G - C T - A G - C T G T C T C C C A T A A G | + | | | A T A G T G G G G G G C G | | | T T G A C A C T A G G TGGCGCAAGCCGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |