Sequence ID | >WENV170704480 |
Genome ID | LLEK01001143 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1836 |
End posion on genome | 1761 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
taaatacaat |
tRNA gene sequence |
TCCTCCTTAGCTCAGTTGGTAGAGCGACGGACTGTTAATCCGCAGGTCGCTGGTTCGAGC |
Downstream region at tRNA end position |
gatttagaaa |
Secondary structure (Cloverleaf model) | >WENV170704480 Asn GTT t GCCA gatttagaaa T - A C - G C - G T - A C - G C - G T - A C G T C G A C C A T G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C T A G AGGTC A C C - G G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |