Sequence ID | >WENV170704499 |
Genome ID | LLEK01001652 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 279 |
End posion on genome | 193 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
catactttgt |
tRNA gene sequence |
GCGGGCGTGGTGAAATCGGTAAACACAGCAGACTTAAAATCTGCCGACCTTTTGGTCTTG |
Downstream region at tRNA end position |
agtaatttca |
Secondary structure (Cloverleaf model) | >WENV170704499 Leu TAA t ACCA agtaatttca G - C C - G G - C G - C G - C C - G G - C T G T C C G C C A T A A G | | | | | A C A G T G G G C G G C G | | | T T G A C A C T A A A CGACCTTTTGGTCTT G - C C - G A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |