Sequence ID | >WENV170704500 |
Genome ID | LLEK01001689 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1361 |
End posion on genome | 1450 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tttttttaaa |
tRNA gene sequence |
GCGGATGTGGTGGAATGGTAGACACGCAAGTTTGAGGGGCTTGTGGGCAAGTAATCGCCC |
Downstream region at tRNA end position |
tataagaagc |
Secondary structure (Cloverleaf model) | >WENV170704500 Leu GAG a ACCA tataagaagc G - C C - G G - C G - C A - T T + G G - C T G T T A C T C A T A A G + | | | | A G G G T G G T G A G C G | | | T T T A C A C A G G TGGGCAAGTAATCGCCCGT C - G A - T A - T G - C T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |