Sequence ID | >WENV170704511 |
Genome ID | LLEK01002117 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1422 |
End posion on genome | 1349 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gttcatttat |
tRNA gene sequence |
GCCCCCATAGTTTAATGGCAAAACGCAGCAATGGTAATGCTGAAATACAAGTTCGATTCT |
Downstream region at tRNA end position |
tttgttattt |
Secondary structure (Cloverleaf model) | >WENV170704511 Thr GGT t ACCA tttgttattt G - C C - G C - G C - G C - G C - G A - T T T T T G C T C A A A A | | | | G T T T T G A C A A G C G | | | | T T G A A A C C A G AAAT C - G A - T G - C C - G A - T A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |