Sequence ID | >WENV170704513 |
Genome ID | LLEK01002179 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1066 |
End posion on genome | 982 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ttctttttgc |
tRNA gene sequence |
GCGGGTGTGGCGAAATTGGCAGACGCACTAGACTTAGGATCTAGCGCCTTACGGCGTGCA |
Downstream region at tRNA end position |
cttatttaaa |
Secondary structure (Cloverleaf model) | >WENV170704513 Leu TAG c ACCA cttatttaaa G - C C - G G - C G - C G - C T - A G - C T C T T G T C C A T A A G + | | | | A T A G C G G C A G G C G | | | T T G A C G C C A G A CGCCTTACGGCGT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |