Sequence ID | >WENV170704517 |
Genome ID | LLEK01002422 |
Phylum/Class | [LLEK] bioreactor metagenome; day79 25degC chemostat 2011 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 59 |
End posion on genome | 146 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cacaatctga |
tRNA gene sequence |
GGATGGCTGGCTGAGTGGTCGAAAGCGGCGGTCTTGAAAACCGTTGAACCGAGAGGTTCC |
Downstream region at tRNA end position |
ttaaaaacct |
Secondary structure (Cloverleaf model) | >WENV170704517 Ser TGA a GCCA ttaaaaacct G - C G - C A - T T - A G - C G - C C - G T A T A T C C C A T G A G | + | | | G G G T C G T G G G G C G | | | T T T A A G C C G A G TGAACCGAGAGGTTCC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |