Sequence ID | >WENV170704584 |
Genome ID | LLEL01002282 |
Phylum/Class | [LLEL] bioreactor metagenome; day35 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 232 |
End posion on genome | 316 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
atattgttct |
tRNA gene sequence |
GGGCAGATTCCAGAGTGGCCAAATGGGGCGGACTGTAAATCCGCTAGCTTCGCTTTCGGG |
Downstream region at tRNA end position |
tttatgtaaa |
Secondary structure (Cloverleaf model) | >WENV170704584 Tyr GTA t ACCA tttatgtaaa G - C G - C G - C C - G A - T G - C A - T T C T C T C C C A T G A T | + | | | G G G A C C G G G G G C G | | | T T C A T G G C A A G TAGCTTCGCTTTC G - C C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |