Sequence ID | >WENV170704598 |
Genome ID | LLEL01005969 |
Phylum/Class | [LLEL] bioreactor metagenome; day35 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 369 |
End posion on genome | 283 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aaagttcaat |
tRNA gene sequence |
GCCAGTGTGATGGAATTGGTAGACATGACGGATTCAAAATCCGTTGCCAGCAATGGCGTA |
Downstream region at tRNA end position |
taactctttg |
Secondary structure (Cloverleaf model) | >WENV170704598 Leu CAA t ACCA taactctttg G + T C - G C - G A - T G - C T - A G - C T G T T C G C C A T A A G | | | | | A T G G T A A G C G G C G | | | T T G A C A T T A G G TGCCAGCAATGGCGT A - T C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |