Sequence ID | >WENV170704671 |
Genome ID | LLEL01029336 |
Phylum/Class | [LLEL] bioreactor metagenome; day35 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 33 |
End posion on genome | 119 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ttacactagt |
tRNA gene sequence |
GCGAGTGTGGCGGAATAGGTAGACGCGTTGGACTTAAAATCCAATTCCGGTTTCGGAGTG |
Downstream region at tRNA end position |
ctgtgttata |
Secondary structure (Cloverleaf model) | >WENV170704671 Leu TAA t ACCA ctgtgttata G - C C - G G - C A - T G + T T - A G - C T T T C A C T C A T A A G | | | | | G A G G C G G T G A G C G | | | T T G A C G C T A G G TTCCGGTTTCGGAGT T - A T - A G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |