Sequence ID | >WENV170704684 |
Genome ID | LLEL01035392 |
Phylum/Class | [LLEL] bioreactor metagenome; day35 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 111 |
End posion on genome | 21 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cacaatttgt |
tRNA gene sequence |
GGAAGGATGGCTGAGTGGCTTAAGGCGCTCGCCTGGAAAGCGAGTATACGTTTATAGCGT |
Downstream region at tRNA end position |
ctattcaaaa |
Secondary structure (Cloverleaf model) | >WENV170704684 Ser GGA t ACCA ctattcaaaa G - C G - C A - T A - T G - C G - C A - T T A T A C C C C A T G A G | | | | | A G G T C G T G G G G C G + | | T T C A G G C T T A G TATACGTTTATAGCGTATC C - G T - A C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |