Sequence ID | >WENV170704686 |
Genome ID | LLEL01036206 |
Phylum/Class | [LLEL] bioreactor metagenome; day35 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 189 |
End posion on genome | 105 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gacacaccct |
tRNA gene sequence |
GGAGGGGTTCCCGAGTGGCCAAAGGGAGCAGACTGTAAATCTGCCGGCACTGCCTTCGAT |
Downstream region at tRNA end position |
tattcttctt |
Secondary structure (Cloverleaf model) | >WENV170704686 Tyr GTA t ACCA tattcttctt G - C G - C A - T G - C G - C G - C G + T T A T C T G C C A T G A T | | + | | G G G C C C G A T G G C G | | | T T C A G G G C A A A CGGCACTGCCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |