Sequence ID | >WENV170704691 |
Genome ID | LLEM01000030 |
Phylum/Class | [LLEM] bioreactor metagenome; day64 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 32661 |
End posion on genome | 32586 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ctgcacttgt |
tRNA gene sequence |
GCCGACTTAGCTCAGTAGGTAGAGCAACTGACTTGTAATCAGTAGGTCACCAGTTCGACT |
Downstream region at tRNA end position |
ctattttgaa |
Secondary structure (Cloverleaf model) | >WENV170704691 Thr TGT t ACCA ctattttgaa G - C C - G C - G G - C A - T C - G T - A T C T T G G C C A T G A A | | | | G A C T C G A C C A G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |