Sequence ID | >WENV170704696 |
Genome ID | LLEM01000068 |
Phylum/Class | [LLEM] bioreactor metagenome; day64 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 9937 |
End posion on genome | 10027 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cccccacaac |
tRNA gene sequence |
GGAGAGATGGCTGAGTGGTTGAAAGCACCGGTCTTGAAAACCGGCATACGTTTGTAGCGT |
Downstream region at tRNA end position |
cattcaagaa |
Secondary structure (Cloverleaf model) | >WENV170704696 Ser TGA c GCCA cattcaagaa G - C G - C A - T G - C A - T G - C A - T T A T A T C C C A T G A G | | | | | A G G T C G T A G G G C G | | | T T T A A G C T G A A CATACGTTTGTAGCGTATC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |