Sequence ID | >WENV170704700 |
Genome ID | LLEM01000126 |
Phylum/Class | [LLEM] bioreactor metagenome; day64 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 4367 |
End posion on genome | 4291 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gcacactggc |
tRNA gene sequence |
CCCCCCTTAGCTCAGTGGTTAGAGCAGGCGACTCATAATCGCTTGGTCCACAGTTCAAGT |
Downstream region at tRNA end position |
Atatatagaa |
Secondary structure (Cloverleaf model) | >WENV170704700 Met CAT c CACC Atatatagaa C C C - G C - G C - G C - G C - G T - A T G T G T G T C A T G A A | | | | | A G C T C G C A C A G C G | | | | T T T G A G C T A A TGGTC G + T G - C C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |