Sequence ID | >WENV170704715 |
Genome ID | LLEM01000361 |
Phylum/Class | [LLEM] bioreactor metagenome; day64 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 81 |
End posion on genome | -1 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ccctgcatct |
tRNA gene sequence |
GCCCGAGTGGTGAAATTGGTATACACGACGGATTCAAAATCCGTTGCTTTCGAGCGTGAC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170704715 Leu CAA t NNnn nnnnnnnnnn G - C C - G C - G C - G G - C A - T G - C T G T C T G C C A T A A G | | | | | A T A G T G G A C G G C G | | | T T G A C A C T A T G TGCTTTCGAGCGT A - T C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |