Sequence ID | >WENV170704721 |
Genome ID | LLEM01000807 |
Phylum/Class | [LLEM] bioreactor metagenome; day64 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1348 |
End posion on genome | 1424 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
caactctaca |
tRNA gene sequence |
GGGGGCGTCGCCAAGCGGTAAGGCAGCAGGTTTTGATCCTGCCATGCGTTGGTTCGAATC |
Downstream region at tRNA end position |
cattacgaaa |
Secondary structure (Cloverleaf model) | >WENV170704721 Gln TTG a GCCA cattacgaaa G + T G - C G - C G - C G - C C C G - C C C T G C C G A T G A C + | | + | A C A C C G T G G T T A G | | | C G G A G G C T A A CATGCGT G - C C - G A - T G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |