Sequence ID | >WENV170704724 |
Genome ID | LLEM01000887 |
Phylum/Class | [LLEM] bioreactor metagenome; day64 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1581 |
End posion on genome | 1659 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
gcaatgttct |
tRNA gene sequence |
AGGCCAGTAGCTCAATTGGCAGAGCGACGGTCTCCAAAACCGTAGGTTGGGGGGGGTTCG |
Downstream region at tRNA end position |
gcttttataa |
Secondary structure (Cloverleaf model) | >WENV170704724 Trp CCA t GCCA gcttttataa A - T G - C G - C C - G C - G A - T G - C T T T C T C C C A T A A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C C A G AGGTTGGG A - T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |