Sequence ID | >WENV170704732 |
Genome ID | LLEM01001366 |
Phylum/Class | [LLEM] bioreactor metagenome; day64 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 230 |
End posion on genome | 150 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aatacggacG |
tRNA gene sequence |
CGGGGGGGTGGAGCAGCTTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGTCGGTTCAA |
Downstream region at tRNA end position |
attctccttt |
Secondary structure (Cloverleaf model) | >WENV170704732 Met CAT G ACCA attctccttt C A G - C G G G - C G - C G - C G - C C C G C C C G G T C G A C T | | + + A T G A G G C G G T T A T + | C A G G C T C G T A G AGGTCGT T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |