Sequence ID | >WENV170704734 |
Genome ID | LLEM01001439 |
Phylum/Class | [LLEM] bioreactor metagenome; day64 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1027 |
End posion on genome | 1111 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
acgtttagat |
tRNA gene sequence |
GGCTAGATGGTGGAATTGGTCTACACACAGCATTCAAAATGCTGCGGCGAAAGCCTTGCG |
Downstream region at tRNA end position |
tatttaaaga |
Secondary structure (Cloverleaf model) | >WENV170704734 Leu CAA t ACCA tatttaaaga G + T G - C C - G T - A A - T G - C A - T T G T C G C C C A T A A G | | | | | G T G G T G G C G G G C G | | | T T G A C A C T C T A CGGCGAAAGCCTT C - G A - T G - C C - G A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |