Sequence ID | >WENV170704762 |
Genome ID | LLEM01007501 |
Phylum/Class | [LLEM] bioreactor metagenome; day64 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 225 |
End posion on genome | 140 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aacaccccgt |
tRNA gene sequence |
GGAGGGGGTTCCCGAGTGGCCAAAGGGATCAGACTGTAAATCTGACGGCTCCGCCTTCGA |
Downstream region at tRNA end position |
tcattatgaa |
Secondary structure (Cloverleaf model) | >WENV170704762 Tyr GTA t ACCA tcattatgaa G - C G - C A - T G - C G - C G - C G + T T A G C T A C C A T G A G T | | | | | G G C C C T G A T G G C G | | + T T C A G G G C A A A CGGCTCCGCCTTC T - A C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |