Sequence ID | >WENV170704783 |
Genome ID | LLEN01000018 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 33097 |
End posion on genome | 33006 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
cgcagtttcG |
tRNA gene sequence |
GAATGAGATGAGGTCTGGTGGCCTTCTCGGTCTTCAAAACCGATGTGAGCTGAATAGGCT |
Downstream region at tRNA end position |
tttcaagcgc |
Secondary structure (Cloverleaf model) | >WENV170704783 SeC(p) TCA G GCCA tttcaagcgc G - C A C A - T T T G - C A - T G - C T T A C G T C C A T C T T | | | | | G G G G A G G C A G G C G | | | + T T T C C T T G G C TGTGAGCTGAATAGGCTCTG T - A C - G G - C G - C T - A C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |