Sequence ID | >WENV170704784 |
Genome ID | LLEN01000020 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 1204 |
End posion on genome | 1120 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
taaagattta |
tRNA gene sequence |
GCCGAGATGGTGAAATTGGTAGACACGCTAGCATGAGGTGCTAGTGCCGCAAGGTGTAGG |
Downstream region at tRNA end position |
ttattcgtta |
Secondary structure (Cloverleaf model) | >WENV170704784 Leu GAG a ACCA ttattcgtta G - C C - G C - G G - C A - T G - C A - T T G T T C C C C A T A A G | | | | | A T A G T G A G G G G C G | | | T T G A C A C T A G G TGCCGCAAGGTGT C - G T - A A - T G - C C - G A T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |