Sequence ID | >WENV170704799 |
Genome ID | LLEN01000109 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 17674 |
End posion on genome | 17599 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
aaaattgtgt |
tRNA gene sequence |
GCTGGTATGGCTCAGTTGGTAGAGCGCACCCTTGGTAAGGGTGAGGTCCCCAGTTCGAAT |
Downstream region at tRNA end position |
ttattttgtt |
Secondary structure (Cloverleaf model) | >WENV170704799 Thr GGT t ACCA ttattttgtt G - C C - G T - A G + T G - C T - A A - T T A T G G G T C A T G A G | | | | | G T C T C G C C C A G C G | | | | T T G G A G C T A G AGGTC C - G A - T C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |