Sequence ID | >WENV170704800 |
Genome ID | LLEN01000110 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 17615 |
End posion on genome | 17691 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
acaatacgga |
tRNA gene sequence |
CGCGGGGTGGAGCAGCTTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGTCGGTTCAAA |
Downstream region at tRNA end position |
attctccttt |
Secondary structure (Cloverleaf model) | >WENV170704800 Met CAT a ACCA attctccttt C A G - C C - G G - C G - C G - C G - C T A T C G G C C A C G A G | + | | | A T C G A G G T C G G C T | | | | T T G G C T C G T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |