Sequence ID | >WENV170704825 |
Genome ID | LLEN01001106 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 915 |
End posion on genome | 1010 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
tggcgcttac |
tRNA gene sequence |
GGAGGGCAATCACATCCGGTGGTGTGGCCGGATTTCAAATCCGGTTGGGGACGGCAGCCG |
Downstream region at tRNA end position |
cttcgtagca |
Secondary structure (Cloverleaf model) | >WENV170704825 SeC(p) TCA c GCCA cttcgtagca G - C G - C A - T G - C G - C G - C C - G A - T T C A C A C C C A C C T T | | | | | G G A C A C G T G G G C G | | | | T T T T G T G G G G TTGGGGACGGCAGCCGTTCCTGG C - G C - G G - C G - C A - T T A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |