Sequence ID | >WENV170704835 |
Genome ID | LLEN01002881 |
Phylum/Class | [LLEN] bioreactor metagenome; day86 10degC chemostat 2012 inoculated with Wadden Sea sediment taken from the upper 2 cm of the |
Species | |
Start position on genome | 363 |
End posion on genome | 437 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
acaactctac |
tRNA gene sequence |
AGGGGCGTCGCCAAGCGGTAAGGCAGCAGGTTTTGATCCTGCCATGCGTTGGTTCGAATC |
Downstream region at tRNA end position |
cattacgaaa |
Secondary structure (Cloverleaf model) | >WENV170704835 Gln TTG c GCCA cattacgaaa A - T G - C G - C G - C G - C C - G G - C T A T C G A C C A G A C | + | | | G C A C C G G T T G G C G | | | T T G A G G C T A A CATGC G - C C - G A - T G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |